circad | circRNAs associated with diseases

rno circ 0005854
Gene	n/a	Organism	Rat
Genome Locus	n/a	Build	n/a
Disease	Neuropathy	ICD-10	Hereditary and idiopathic neuropathy (G60)
DBLink	Link to database	PMID	28420964
Experimental Method
Sample Type	Tissues	Comparison	12 rats for SNI and sham operation. At 14 days after operation, three rats were randomly selected in each group and deeply anesthetized with isoflurane after the behavioral test.
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGCAGAGGAACTGAGTATGG Reverse CAGGGACTCTGTCCCCTTTC	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Zhou, J, Xiong, Q, Chen, H, Yang, C, Fan, Y (2017). Identification of the Spinal Expression Profile of Non-coding RNAs Involved in Neuropathic Pain Following Spared Nerve Injury by Sequence Analysis. Front Mol Neurosci, 10:91.